nextflow.config

/*
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    nf-core/smrnaseq Nextflow config file
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    Default config options for all compute environments
----------------------------------------------------------------------------------------
*/

// Global default params, used in configs
params {

    // Input options

    input                       = null

    // Workflow flags
    protocol                    = 'illumina'

    // References
    genome                      = null
    igenomes_base               = 's3://ngi-igenomes/igenomes'
    igenomes_ignore             = false
    mirna_gtf                   = null
    mature                      = "https://mirbase.org/download/mature.fa"
    hairpin                     = "https://mirbase.org/download/hairpin.fa"
    mirgenedb                   = false
    mirgenedb_mature            = null
    mirgenedb_hairpin           = null
    mirgenedb_gff               = null
    mirgenedb_species           = null
    save_aligned                = false
    save_aligned_mirna_quant    = true
    bowtie_index                = null

    // UMI handling
    with_umi                      = false
    // skips umitools extract in FASTQ_FASTQC_UMITOOLS_FASTP subworkflow. Needs to be true for fastq mode in collapsing reads
    skip_umi_extract_before_dedup = true
    umitools_extract_method       = 'string'
    umitools_bc_pattern           = null
    umi_discard_read              = null
    umitools_method               = 'dir'
    save_umi_intermeds            = false

    // Trimming options
    clip_r1                     = null
    three_prime_clip_r1         = null
    three_prime_adapter         = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA'
    trim_fastq                  = true
    fastp_min_length            = 17
    fastp_known_mirna_adapters  = "$projectDir/assets/known_adapters.fa"
    save_trimmed_fail           = false
    save_merged                 = true
    skip_fastqc                 = false
    skip_multiqc                = false
    skip_mirdeep                = false
    skip_fastp                  = false
    save_reference              = false
    fastp_max_length            = 100
    min_trimmed_reads           = 10

    // Contamination filtering
    filter_contamination        = false
    rrna                        = null
    trna                        = null
    cdna                        = null
    ncrna                       = null
    pirna                       = null
    other_contamination         = null

    //FASTQ handling defaults, for mirtrace
    phred_offset = 33

    // References
    genome                     = null
    igenomes_base              = 's3://ngi-igenomes/igenomes/'
    igenomes_ignore            = false


    // MultiQC options
    multiqc_config             = null
    multiqc_title              = null
    multiqc_logo               = null
    max_multiqc_email_size     = '25.MB'
    multiqc_methods_description = null

    // Boilerplate options
    outdir                     = null
    publish_dir_mode           = 'copy'
    email                      = null
    email_on_fail              = null
    plaintext_email            = false
    monochrome_logs            = false
    hook_url                   = null
    help                       = false
    version                    = false

    // Config options
    config_profile_name        = null
    config_profile_description = null
    custom_config_version      = 'master'
    custom_config_base         = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}"
    config_profile_contact     = null
    config_profile_url         = null


    // Max resource options
    // Defaults only, expecting to be overwritten
    max_memory                  = '128.GB'
    max_cpus                    = 16
    max_time                    = '240.h'

    // Schema validation default options
    validationFailUnrecognisedParams = false
    validationLenientMode            = false
    validationSchemaIgnoreParams     = 'genomes,igenomes_base'
    validationShowHiddenParams       = false
    validate_params                  = true

}

// Load base.config by default for all pipelines
includeConfig 'conf/base.config'

// Load nf-core custom profiles from different Institutions
try {
    includeConfig "${params.custom_config_base}/nfcore_custom.config"
} catch (Exception e) {
    System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config")
}

// Load nf-core/smrnaseq custom profiles from different institutions.
// Warning: Uncomment only if a pipeline-specific institutional config already exists on nf-core/configs!
// try {
//   includeConfig "${params.custom_config_base}/pipeline/smrnaseq.config"
// } catch (Exception e) {
//   System.err.println("WARNING: Could not load nf-core/config/smrnaseq profiles: ${params.custom_config_base}/pipeline/smrnaseq.config")
// }

profiles {
    debug {
        dumpHashes             = true
        process.beforeScript   = 'echo $HOSTNAME'
        cleanup                = false
        nextflow.enable.configProcessNamesValidation = true
    }
    conda {
        conda.enabled          = true
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        channels               = ['conda-forge', 'bioconda', 'defaults']
        apptainer.enabled      = false
    }
    mamba {
        conda.enabled          = true
        conda.useMamba         = true
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    docker {
        docker.enabled         = true
        conda.enabled          = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
        docker.runOptions      = '-u $(id -u):$(id -g)'
    }
    arm {
        docker.runOptions      = '-u $(id -u):$(id -g) --platform=linux/amd64'
    }
    singularity {
        singularity.enabled    = true
        singularity.autoMounts = true
        conda.enabled          = false
        docker.enabled         = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    podman {
        podman.enabled         = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        shifter.enabled        = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    shifter {
        shifter.enabled        = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        charliecloud.enabled   = false
        apptainer.enabled      = false
    }
    charliecloud {
        charliecloud.enabled   = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        apptainer.enabled      = false
    }
    apptainer {
        apptainer.enabled      = true
        apptainer.autoMounts   = true
        conda.enabled          = false
        docker.enabled         = false
        singularity.enabled    = false
        podman.enabled         = false
        shifter.enabled        = false
        charliecloud.enabled   = false
    }
    gitpod {

        executor.name           = 'local'
        executor.cpus           = 16
        executor.memory         = 60.GB

    }
    test           { includeConfig 'conf/test.config' }
    test_umi       { includeConfig 'conf/test_umi.config' }
    test_no_genome { includeConfig 'conf/test_no_genome.config' }
    test_full      { includeConfig 'conf/test_full.config' }
    test_index     { includeConfig 'conf/test_index.config' }
}

// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile
// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled
// Set to your registry if you have a mirror of containers
apptainer.registry   = 'quay.io'
docker.registry      = 'quay.io'
podman.registry      = 'quay.io'
singularity.registry = 'quay.io'

// Nextflow plugins
plugins {
    id 'nf-validation@1.1.3' // Validation of pipeline parameters and creation of an input channel from a sample sheet
}

// Load igenomes.config if required
if (!params.igenomes_ignore) {
    includeConfig 'conf/igenomes.config'
} else {
    params.genomes = [:]
}

// Export these variables to prevent local Python/R libraries from conflicting with those in the container
// The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container.
// See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable.

env {
    PYTHONNOUSERSITE = 1
    R_PROFILE_USER   = "/.Rprofile"
    R_ENVIRON_USER   = "/.Renviron"
    JULIA_DEPOT_PATH = "/usr/local/share/julia"
}

// Capture exit codes from upstream processes when piping
process.shell = ['/bin/bash', '-euo', 'pipefail']

// Set default registry for Docker and Podman independent of -profile
// Will not be used unless Docker / Podman are enabled
// Set to your registry if you have a mirror of containers
apptainer.registry   = 'quay.io'
docker.registry      = 'quay.io'
podman.registry      = 'quay.io'
singularity.registry = 'quay.io'

// Disable process selector warnings by default. Use debug profile to enable warnings.
nextflow.enable.configProcessNamesValidation = false

def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
timeline {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html"
}
report {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html"
}
trace {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt"
}
dag {
    enabled = true
    file    = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html"
}

manifest {
    name            = 'nf-core/smrnaseq'
    author          = """P. Ewels, C. Wang, R. Hammarén, L. Pantano, A. Peltzer"""
    homePage        = 'https://github.com/nf-core/smrnaseq'
    description     = """Small RNA-Seq Best Practice Analysis Pipeline."""
    mainScript      = 'main.nf'
    nextflowVersion = '!>=23.04.0'
    version         = '2.3.1'
    doi             = '10.5281/zenodo.3456879'
}

// Load modules.config for DSL2 module specific options
includeConfig 'conf/modules.config'

// Function to ensure that resource requirements don't go beyond
// a maximum limit
def check_max(obj, type) {
    if (type == 'memory') {
        try {
            if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1)
                return params.max_memory as nextflow.util.MemoryUnit
            else
                return obj
        } catch (all) {
            println "   ### ERROR ###   Max memory '${params.max_memory}' is not valid! Using default value: $obj"
            return obj
        }
    } else if (type == 'time') {
        try {
            if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1)
                return params.max_time as nextflow.util.Duration
            else
                return obj
        } catch (all) {
            println "   ### ERROR ###   Max time '${params.max_time}' is not valid! Using default value: $obj"
            return obj
        }
    } else if (type == 'cpus') {
        try {
            return Math.min( obj, params.max_cpus as int )
        } catch (all) {
            println "   ### ERROR ###   Max cpus '${params.max_cpus}' is not valid! Using default value: $obj"
            return obj
        }
    }

}